Skip to content

find

Search for pattern(s) in sequences or sequene headers for record filtering, pattern replacement or passing hits to next command

There are different search modes:

  1. Exact search
  2. Regular expressions (-r/--regex)
  3. DNA or protein patterns with ambiguous letters
  4. Approximate matching up to a given edit distance (-D/--diffs or -R/--max-diff-rate)

Search results can be used in three different ways:

  1. Keeping (-f/--filter) or excluding (-e/--exclude) matched sequences
  2. Pattern replacement (--rep) with ambiguous/approximate matching (for exact/regex replacement, use the 'replace' command)
  3. Passing the search results to the output in sequence headers (-a/--attr) or TSV/CSV fields (--to-tsv/--to-csv); see st find --help-vars for all possible variables/ functions

Usage: st find [OPTIONS] <PATTERNS> [INPUT]...

Arguments:
  <PATTERNS>  Pattern string or 'file:<patterns.fasta>'

Options:
  -h, --help  Print help

Where to search (default: sequence):
  -i, --id    Search / replace in IDs instead of sequences
  -d, --desc  Search / replace in descriptions

Search options:
  -D, --max-diffs <N>      Return pattern matches up to a given maximum edit
                           distance of N differences (= substitutions,
                           insertions or deletions). Residues that go beyond the
                           sequence (partial matches) are always counted as
                           differences. [default: pefect match]
  -R, --max-diff-rate <R>  Return of matches up to a given maximum rate of
                           differences, that is the fraction of divergences
                           (edit distance = substitutions, insertions or
                           deletions) divided by the pattern length. If
                           searching a 20bp pattern at a difference rate of 0.2,
                           matches with up to 4 differences (see also
                           `-D/--max-diffs`) are returned. [default: pefect
                           match]
  -r, --regex              Interpret pattern(s) as regular expression(s). All
                           *non-overlapping* matches in are searched in headers
                           or sequences. The regex engine lacks some advanced
                           syntax features such as look-around and
                           backreferences (see https://docs.rs/regex/#syntax).
                           Capture groups can be extracted by functions such as
                           `match_group(number)`, or `match_group(name)` if
                           named: `(?<name>)` (see also `st find --help-vars`)
      --in-order           Report hits in the order of their occurrence instead
                           of sorting by distance. Note that this option only
                           has an effect with `-D/--max-dist` > 0, otherwise
                           matches are always reported in the order of their
                           occurrence
  -t, --threads <N>        Number of threads to use for searching [default: 1]
      --no-ambig           Don't interpret DNA ambiguity (IUPAC) characters
      --algo <NAME>        Override decision of algorithm for testing
                           (regex/exact/myers/auto) [default: auto]
      --gap-penalty <N>    Gap penalty used for prioritizing among multiple
                           matches with the same starting position and an
                           equally small edit distance. While substitutions have
                           a fixed penalty of 1, the gap penalty can be modified
                           to take values >1. The default of 2 prefers more
                           concise alignments. A high gap penalty does *not*
                           enforce ungapped alignments. Only perfect matches
                           (`-D/--max-diffs 0`) are ungapped [default: 2]

Search range:
      --rng <RANGE>          Search within the given range ('start:end',
                             'start:' or ':end'). Using variables is not
                             possible
      --max-shift-start <N>  Consider only matches with a maximum of <N> letters
                             preceding the start of the match (relative to the
                             sequence start or the start of the range `--rng`)
      --max-shift-end <N>    Consider only matches with a maximum of <N> letters
                             following the end of the match (relative to the
                             sequence end or the end of the range `--rng`)

Search command actions:
  -f, --filter          Keep only matching sequences
  -e, --exclude         Exclude sequences that matched
      --dropped <FILE>  Output file for sequences that were removed by
                        filtering. The format is auto-recognized from the
                        extension
      --rep <BY>        Replace by a string, which may also contain
                        {variables/functions}
See this page for the options common to all commands.

Searching in headers

Specify -i/--id to search in sequence IDs (everything before the first space) or -d/--desc to search in the description part (everything after the space).

Example: selectively return sequences that have label in their description (filtering with the -f/--filter flag):

st find -df 'label' gb_seqs.fasta

Note: use --dropped <not_matched_out> to write unmatched sequences to another file.

To match a certain pattern, use a regular expression (-r/--regex). The following example extracts Genbank accessions from sequence headers that follow the old-style Genbank format:

st find -ir "gi\|\d+\|[a-z]+\|(?<acc>.+?)\|.*" gb_seqs.fasta -a 'acc={match_group(acc)}'
>gi|1031916024|gb|KU317675.1| acc=KU317675.1
SEQUENCE
(...)

You can use online tools such as https://regex101.com to build and debug your regular expression

Note: You could also replace the whole header with the accession using the replace command. This might be faster, but the original header will not be retained.

Searching in sequences

Without the -i or -d flag, the default mode is to search in the sequence. The pattern type is automatically recognized and usually reported to avoid problems:

st find -f AATGRAAT seqs.fasta > filtered.fasta
Note: the sequence type of the pattern was determined as 'dna' (with ambiguous letters). If incorrect, please provide the correct type with `--seqtype`. Use `-q/--quiet` to suppress this message.

R stands for A or G. Seqtool recognizes the IUPAC ambiguity codes for DNA/RNA and proteins (with the exception of U = Selenocysteine).

Matching is asymmetric: R in a search pattern matches [A, G, R] in sequences, but R in a sequence will only match ambiguities sharing the same set of bases (R, V, D, N) in the pattern. This should prevent false positive matches in sequences with many ambiguous characters.

Approximate matching

Seqtool can search for patterns such as adapter and primer sequences in an error-tolerant way, up to a given edit distance (-D/--diffs argument). Alternatively, -R/--diff-rate specifies a distance threshold relative to the length of the pattern (in other words, an "error rate").

In this example, the edit distance and range of the best match are stored into header attributes. If no hit is found, the attributes are set to undefined.

st find -D 2 AATGRAAT seqs.fasta -a d='{match_diffs}' -a rng='{match_range}'
>seq1 d=1 rng=3:11
GGAACGAAATATCAGCGATCC
>seq2 d=undefined rng=undefined
TTATCGAATATGAGCGATCG
(...)

The second best hit (if any) can be returned with {match_diffs(2)} or {match_range(2)}, etc.

Note: Approximative matching is done using Myers bit-parallel algorithm, which is very fast with short patterns and reasonably short sequences. It may not be the fastest solution if searching in large genomes.

Recognizing adapter or primers should be very fast. Further speedups can be achieved by multithreading (-t) and restricting the search range (--rng).

Note 2: To report all hits below the given distance threshold in order of occurrence instead of decreasing distance, specify --in-order (this may be faster)

Multiple patterns

The find command supports searching for several patterns at once. They have to be supplied in a separate FASTA file (file:path). The best matching pattern with the smallest edit distance is always reported first.

The following example de-multiplexes sequences amplified with different forward primers and then uses trim to remove the primers, and finally distributes the sequences into different files named by the forward primer (split).

primers.fasta
>prA
PRIMER
>prB
PRIMER
st find file:primers.fasta -a primer='{pattern_name}' -a end='{match_end}' sequences.fasta |
    st trim -e '{attr(end)}:' |
    st split -o '{attr(primer)}'
prA.fasta prB.fasta undefined.fasta
>id1 primer=prA end=22
SEQUENCE
>id4 primer=prA end=21
SEQUENCE
(...)
>id2 primer=prB end=20
SEQUENCE
>id3 primer=prB end=22
SEQUENCE
(...)
>id5 primer=undefined end=undefined
UNTRIMMEDSEQUENCE
(...)
> Note: no primer, sequence not trimmed since end=undefined (see ranges).

Selecting other hits

The find command is very versatile thanks to the large number of variables/functions that provide information about the search results (see variable reference).

For instance, the best hit from the second best matching pattern can be selected using {match_range(1, 2)}.

It is also possible to return a comma-delimited list of matches, e.g.: {match_range(all)}. See the mask command for an example on how this could be useful.

Replacing matches

Hits can be replaced by other text (--repl). Variables are allowed as well (in contrast to the replace command). Backreferences to regex groups (e.g. $1) are not supported like the replace command does. Instead, they can be accessed using variables (match_group(), etc.)

More

This page lists more examples with execution times and comparisons with other tools.

Variables/functions provided by the 'find' command

see also st find --help-vars

The find command provides many variables/functions to obtain information about the pattern matches. These are either written to header attributes (-a/--attr) or CSV/TSV fields (e.g. --to-tsv ...). See also examples section below.

match
match(hit)
match(hit, pattern)
The text matched by the pattern. With approximate matching (-D/--diffs > 0), this is the match with the smallest edit distance or the leftmost occurrence if --in-order was specified. With exact/regex matching, the leftmost hit is always returned. In case of multiple patterns in a pattern file, the best hit of the best-matching pattern is returned (fuzzy matching), or the first hit of the first pattern with an exact match.
match(hit) returns the matched text of the given hit number, whereasmatch(all)ormatch('all') returns a comma-delimited list of all hits. These are either sorted by the edit distance (default) or by occurrence (--in-order or exact matching).
match(1, 2), match(1, 3), etc. references the 2nd, 3rd, etc. best matching pattern in case multiple patterns were suplied in a file (default: hit=1, pattern=1)."
aligned_match
aligned_match(hit)
aligned_match(hit, rank)
Text match aligned with the pattern, including gaps if needed.
match_start
match_start(hit)
match_start(hit, pattern)
Start coordinate of the first/best match. Other hits/patterns are selected with match_start(hit, [pattern]), for details see match
match_end
match_end(hit)
match_end(hit, pattern)
Start of the first/best match relative to sequence end (negative coordinate). Other hits/patterns are selected with match_neg_start(hit, [pattern]), for details see match.
match_neg_start
match_neg_start(hit)
match_neg_start(hit, pattern)
End of the first/best match relative to sequence end (negative coordinate). Other hits/patterns are selected with match_neg_end(hit, [pattern]), for details see match.
match_neg_end
match_neg_end(hit)
match_neg_end(hit, pattern)
End coordinate of the first/best match. Other hits/patterns are selected with match_end(hit, [pattern]), for details see match
match_len
match_len(hit)
match_len(hit, rank)
Length of the match
match_range
match_range(hit)
match_range(hit, pattern)
match_range(hit, pattern, delim)
Range (start:end) of the first/best match. Other hits/patterns are selected with match_range(hit, [pattern]), for details see match. The 3rd argument allows changing the range delimiter, e.g. to '-'.
match_group(group)
match_group(group, hit)
match_group(group, hit, pattern)
Text matched by regex match group of given number (0 = entire match) or name in case of a named group: (?\<name\>...). The hit number (sorted by edit distance or occurrence) and the pattern number can be specified as well (see match for details).
match_grp_start(group)
match_grp_start(group, hit)
match_grp_start(group, hit, pattern)
Start coordinate of the regex match group 'group' within the first/best match. See 'match_group' for options and details.
match_grp_end(group)
match_grp_end(group, hit)
match_grp_end(group, hit, pattern)
End coordinate of the regex match group 'group' within the first/best match. See 'match_group' for options and details.
match_grp_neg_start(group)
match_grp_neg_start(group, hit)
match_grp_neg_start(group, hit, pattern)
Start coordinate of regex match group 'group' relative to the sequence end (negative number). See 'match_group' for options and details.
match_grp_neg_end(group)
match_grp_neg_end(group, hit)
match_grp_neg_end(group, hit, pattern)
Start coordinate of regex match group 'group' relative to the sequence end (negative number). See 'match_group' for options and details.
match_grp_range(group)
match_grp_range(group, hit)
match_grp_range(group, hit, pattern)
match_grp_range(group, hit, pattern, delim)
Range (start-end) of regex match group 'group' relative to the sequence end. See 'match_group' for options and details. The 4th argument allows changing the range delimiter, e.g. to '-'.
match_diffs
match_diffs(hit)
match_diffs(hit, pattern)
Number of mismatches/insertions/deletions of the search pattern compared to the sequence (corresponds to edit distance). Either just match_diffs for the best match, or match_diffs(h, [p]) to get the edit distance of the h-th best hit of the p-th pattern. `match_diffs('all', [p]) will return a comma delimited list of distances for all hits of a pattern.
match_diff_rate
match_diff_rate(hit)
match_diff_rate(hit, pattern)
Number of insertions in the sequence compared to the search pattern. Proportion of differences between the search pattern and the matched sequence, relative to the pattern length. See match_diffs for details on hit/pattern arguments.
match_ins
match_ins(hit)
match_ins(hit, pattern)
Number of insertions in the matched sequence compared to the search pattern.
match_del
match_del(hit)
match_del(hit, pattern)
Number of deletions in the matched text sequence to the search pattern.
match_subst
match_subst(hit)
match_subst(hit, pattern)
Number of substitutions (non-matching letters) in the matched sequence compared to the pattern
pattern_name
pattern_name(rank)
Name of the matching pattern (patterns supplied with file:patterns.fasta). In case a single pattern was specified in the commandline, this will just be \<pattern>. pattern_name(rank) selects the n-th matching pattern, sorted by edit distance and/or pattern number (depending on -D/-R and --in-order).
pattern
pattern(rank)
The best-matching pattern sequence, or the n-th matching pattern if rank is given, sorted by edit distance or by occurrence (depending on -D/-R and --in-order).
aligned_pattern
aligned_pattern(hit)
aligned_pattern(hit, rank)
The aligned pattern, including gaps if needed. Regex patterns are returned as-is.
pattern_len
pattern_len(rank)
Length of the matching pattern (see also pattern). For regex patterns, the length of the complete regular expression is returned.

Examples

Find a primer sequence with up to 2 mismatches (-d/--dist) and write the match range and the mismatches ('dist') to the header as attributes. The result will be 'undefined' (=undefined in JavaScript) if there are > 2 mismatches:

st find -d 2 CTTGGTCATTTAGAGGAAGTAA -a rng={match_range} -a dist={match_diffs} reads.fasta
>id1 rng=2:21 dist=1
SEQUENCE
>id2 rng=1:20 dist=0
SEQUENCE
>id3 rng=undefined dist=undefined
SEQUENCE
(...)
Find a primer sequence and if found, remove it using the 'trim' command, while non-matching sequences are written to 'no_primer.fasta':
st find -f -d 2 CTTGGTCATTTAGAGGAAGTAA --dropped no_primer.fasta -a end={match_end} reads.fasta |
   st trim -e '{attr(match_end)}:' > primer_trimmed.fasta
Search for several primers with up to 2 mismatches and write the name and mismatches of the best-matching primer to the header:
st find -d 2 file:primers.fasta -a primer={pattern_name} -a dist={match_diffs} reads.fasta
>id1 primer=primer_1 dist=1
SEQUENCE
>id1 primer=primer_2 dist=0
SEQUENCE
>id1 primer=undefined dist=undefined
SEQUENCE
(...)